missing translation for 'onlineSavingsMsg'
Learn More
Learn More
Thermo Scientific™ T3 promoter Sequencing Primer, 24-mer
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.
Merk: Thermo Scientific™ SO120
This item is not returnable.
View return policy
Beschrijving
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II
Promoter Sequence 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'
Related products
SP6 promoter Sequencing Primer, 18-mer (SO116)
T3 promoter Sequencing Primer, 17-mer (SO119)
SP6 promoter Sequencing Primer, 24-mer (SO117)
T7 promoter Sequencing Primer, 20-mer (SO118)
Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated
Specificatie
| SP6, T3, T7 | |
| T3 promoter Sequencing Primer, 24-mer, 10 μM (42 μL) Store at –20°C. |
|
| 10 μM | |
| 10 μM, 42 μL | |
| Liquid |
| Sequencing Primer | |
| Dry Ice | |
| T3 | |
| Sequencing |
Product Content Correction
Your input is important to us. Please complete this form to provide feedback related to the content on this product.
Product Title
For Research Use Only. Not for use in diagnostic procedures.
Spot an opportunity for improvement?Share a Content Correction